Description:
The pTK-CLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive HSV thymidkine kinase promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. pTK-CLuc has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation site. pTK-CLuc contains a selectable marker that is suited for creating stable integrants in the mammalian cell genome.
Recommended sequencing primers for pTK-CLuc Vector (not available from NEB)
pBasic Reverse Primer (25-mer)
TCAGAAGCCATAGAGCCCACCGCAT (2827-2803)
CLuc 3´ end Forward Primer (23-mer)
GAGTTCAAGAAAGAATGCTACAT (2397-2419)
CLuc 5´ End Reverse Primer (24-mer)
GTAAGGACAGTCCTGGCAATGAAC (869-846)